EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr10:33625493-33626163]
Chromosome characteristics of ZNF143[chr10:33625493-33626163]
Back to top
Enhancers possibly regulated by ZNF143[chr10:33625493-33626163]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 33625950 33626342 vista7105
VISTA
SNP sites on ZNF143[chr10:33625493-33626163]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 33625494 rs61758226 C G 1325828
chr10 33625546 rs538192990 G A 1325829
chr10 33625547 rs556697263 C A 1325830
chr10 33625570 rs187186424 T G 1325831
chr10 33625830 rs561159256 C T 1325832
chr10 33625844 rs576265135 G A 1325833
chr10 33625930 rs150189270 G T 1325834
chr10 33626134 rs529757280 C A 1325835
chr10 33626149 rs150794674 T TCTCCACCGCTCCCTCCTGC 1325836
chr10 33626149 rs79540282 T TCTCCACCGCTCCCTCCTGC 1325837
Genes possibly regulated by ZNF143[chr10:33625493-33626163]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr10 33466420 33625190 - NRP1 ENSG00000099250.13 33625190 0.83 0.96 303 9723
Expression level of Genes
Back to top
miRNAs possibly regulated by ZNF143[chr10:33625493-33626163]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results