Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 33625950 33626342 vista7105

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 33626134 rs529757280 C A 1325835
chr10 33626149 rs150794674 T TCTCCACCGCTCCCTCCTGC 1325836
chr10 33626149 rs79540282 T TCTCCACCGCTCCCTCCTGC 1325837

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr10 33466420 33625190 - NRP1 ENSG00000099250.13 33625190 0.83 0.96 783 9723


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results