Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 89500062 89500398 vista8193

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 89499989 rs568806579 C T 1558667
chr10 89500020 rs539505023 TTGATGAGACTAGTAGTGATATTAACACATGTG T 1558668
chr10 89500079 rs557477966 CAT C 1558669
chr10 89500341 rs12780234 G T 1558670

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results