| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr10 | 89500062 | 89500398 | vista8193 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr10 | 89500020 | rs539505023 | TTGATGAGACTAGTAGTGATATTAACACATGTG | T | 1558668 | |
| chr10 | 89500079 | rs557477966 | CAT | C | 1558669 | |
| chr10 | 89500341 | rs12780234 | G | T | 1558670 | |
| chr10 | 89500496 | rs12240764 | C | T | 1558671 | |
| chr10 | 89500556 | rs111850405 | T | C | 1558672 | |
| chr10 | 89500594 | rs542438401 | A | C | 1558673 | |
| chr10 | 89500612 | rs111420290 | CT | C | 1558674 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|