EnhancerDB
  1. Home
  2. TFBS
  3. AR[chr10:92731076-92732044]
Chromosome characteristics of AR[chr10:92731076-92732044]
Back to top
Enhancers possibly regulated by AR[chr10:92731076-92732044]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr10 92722885 92733795 enh28349
Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Brain (SK-N-SH) Astrocyte Bone (Osteoblast) Lung Lung (A549) Lung (PC-9) Muscle (Myoblast) Spleen Muscle (Myotube)
chr10 92731604 92731862 vista8294
VISTA
SNP sites on AR[chr10:92731076-92732044]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr10 92731134 rs57708293 TCCAGA T 1574819
chr10 92731148 rs192125311 T C 1574820
chr10 92731231 rs181890028 C T 1574821
chr10 92731342 rs554657858 G A,T 1574822
chr10 92731348 rs566518841 G A 1574823
chr10 92731350 rs61859603 G A 1574824
chr10 92731378 rs548956955 G A 1574825
chr10 92731410 rs186875709 G A,T 1574826
chr10 92731445 rs545778521 CACTCCGGCCTGGGCGACAGTGAG C 1574827
chr10 92731580 rs149675691 A T 1574828
chr10 92731717 rs145455752 C T 1574829
chr10 92731759 rs545732069 A G 1574830
chr10 92732008 rs12256541 G A,C 1574831
chr10 92732043 rs114237748 C T 1574832
Genes possibly regulated by AR[chr10:92731076-92732044]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by AR[chr10:92731076-92732044]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results