EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr11:1039285-1039943]
Chromosome characteristics of TCF7L2[chr11:1039285-1039943]
Back to top
Enhancers possibly regulated by TCF7L2[chr11:1039285-1039943]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 1039894 1040259 vista9324
VISTA
SNP sites on TCF7L2[chr11:1039285-1039943]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 1039357 rs566277421 C A 1790632
chr11 1039400 rs184084679 G A 1790633
chr11 1039614 rs76122061 C A,T 1790634
chr11 1039641 rs188832381 C G 1790635
chr11 1039652 rs547880279 C T 1790636
chr11 1039719 rs570103762 G GGTGGGCCCCGGGCCCCAGC 1790637
chr11 1039867 rs9794921 T A,G 1790638
chr11 1039937 rs114467017 G A 1790639
Genes possibly regulated by TCF7L2[chr11:1039285-1039943]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr11:1039285-1039943]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results