Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 1845929 1854335 enh62113
chr11 1851395 1851620 vista9370

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 1850685 rs149433102 T C 1797034
chr11 1850705 rs540731344 T C 1797035
chr11 1850721 rs113907561 AC A 1797036
chr11 1850766 rs566733526 GA G 1797037
chr11 1850828 rs146294060 C A,G,T 1797038
chr11 1850869 rs536568496 G A 1797039
chr11 1850870 rs186637679 C T 1797040
chr11 1850894 rs138194670 C T 1797041
chr11 1850910 rs142800103 G A 1797042
chr11 1850995 rs584547 G A 1797043
chr11 1851028 rs568517010 G T 1797044
chr11 1851051 rs189338005 G A 1797045
chr11 1851052 rs146089042 G C 1797046
chr11 1851075 rs575334493 GTGATGGGGTGCAGCCTCCACGGAGGCTCGA G 1797047
chr11 1851093 rs540094040 C T 1797048
chr11 1851096 rs554630360 G A 1797049
chr11 1851105 rs540847271 A G 1797050
chr11 1851187 rs181755056 A G 1797051
chr11 1851259 rs2334384 G A 1797052
chr11 1851327 rs142143131 G A 1797053

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results