Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 3191153 3191550 vista9455

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 3191217 rs141203520 GATGCACACGTGTGCATGCACACGTGTGC G 1809431
chr11 3191217 rs144729353 GATGCACACGTGTGC G 1809432
chr11 3191217 rs536729559 GATGCACACGTGTGC G 1809433
chr11 3191240 rs574398128 G A 1809434
chr11 3191248 rs398054913 GCA G 1809435
chr11 3191248 rs77806094 GCA G 1809436

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results