Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 10735359 10735758 vista9633

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 10735807 rs543317886 CT C 1843136
chr11 10735907 rs559212429 GCCGTTCTCCTGCCTCAGCCTC G 1843137
chr11 10735919 rs535491244 C A 1843138
chr11 10735930 rs533001168 CGAG C 1843139
chr11 10735954 rs555365918 C T 1843140

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results