EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr11:57336754-57337210]
Chromosome characteristics of ZNF274[chr11:57336754-57337210]
Back to top
Enhancers possibly regulated by ZNF274[chr11:57336754-57337210]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 57336823 57337050 vista10354
VISTA
SNP sites on ZNF274[chr11:57336754-57337210]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 57336760 rs537027305 G A 2009797
chr11 57336778 rs139580718 AAGGGGAGTCCCTGCTCCTG A 2009798
Genes possibly regulated by ZNF274[chr11:57336754-57337210]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr11 57319129 57335757 - UBE2L6 ENSG00000156587.11 57335757 0.69 1.0 997 10846
Expression level of Genes
Back to top
miRNAs possibly regulated by ZNF274[chr11:57336754-57337210]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results