Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 57336823 57337050 vista10354

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 57336778 rs139580718 AAGGGGAGTCCCTGCTCCTG A 2009798

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results