Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 60677775 60678061 vista10419

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 60677941 rs551079592 G C 2021247
chr11 60678022 rs76003272 C A 2021248
chr11 60678123 rs58881868 T G 2021249
chr11 60678217 rs139495558 G A 2021250
chr11 60678242 rs149694301 A C 2021251
chr11 60678244 rs10897125 A G 2021252
chr11 60678492 rs563677008 T A 2021253
chr11 60678513 rs552774759 GAGGGAGACTCAGTAATTAATTGTTGAACCAATCTTTATTGAGT G 2021254

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr11 60681346 60690915 + TMEM109 ENSG00000110108.5 60681346 0.68 0.99 2813 10920


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results