Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 60678569 60679027 vista10420

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 60678492 rs563677008 T A 2021253
chr11 60678513 rs552774759 GAGGGAGACTCAGTAATTAATTGTTGAACCAATCTTTATTGAGT G 2021254
chr11 60678546 rs145444372 C G,T 2021255
chr11 60678566 rs141139996 G A 2021256
chr11 60678575 rs73493026 C T 2021257

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr11 60681346 60690915 + TMEM109 ENSG00000110108.5 60681346 0.68 0.99 2589 10920


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results