Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 60929738 60929978 vista10442
chr11 60930012 60930347 vista10443

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 60928633 rs544461843 G C 2023415
chr11 60928769 rs61251724 G A 2023416
chr11 60929122 rs532744690 G T 2023417
chr11 60929137 rs544709050 C CGGCCCCGCCCCCGGTAAGA 2023418
chr11 60929561 rs567915554 G GT 2023419
chr11 60929588 rs146868145 C A 2023420
chr11 60929637 rs559022139 G A 2023421
chr11 60929661 rs114388018 T C 2023422
chr11 60929708 rs115190889 A T 2023423
chr11 60929876 rs11230619 A G 2023424
chr11 60929989 rs142912622 A G 2023425

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr11 60897728 60929089 - VPS37C ENSG00000167987.6 60929089 0.61 1.0 741 10925


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results