Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 69453520 69454472 vista10774

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 69453600 rs564451020 C G 2076375
chr11 69453651 rs550854114 C T 2076376
chr11 69453692 rs113570969 G A,C 2076377
chr11 69453715 rs3842249 CCGCCGGGCCCCAAATTCCAG C 2076378
chr11 69453715 rs538994010 CCGCCGGGCCCCAAATTCCAG C 2076379
chr11 69453738 rs536058662 CCGGGCCCCAAAT C 2076380
chr11 69453751 rs575570929 TCCAGCGCC T 2076381
chr11 69453759 rs566482901 C T 2076382
chr11 69453915 rs564300844 A C,G 2076383
chr11 69453935 rs1944129 C T 2076384
chr11 69453940 rs36225072 T TG 2076385
chr11 69453940 rs397897301 T TG 2076386
chr11 69453942 rs36225071 G C,T 2076387

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr11 69455855 69469242 + CCND1 ENSG00000110092.3 69455855 0.8 1.0 1901 11184


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results