Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 71936863 71941097 enh115467
chr11 71936800 71937067 vista10835

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 71936199 rs562007112 G A 2092563
chr11 71936225 rs144989913 GGCTCCTTGCGGGCTGGCGTGGACCGGGA G 2092564
chr11 71936248 rs529204687 C G 2092565
chr11 71936430 rs117062675 A G 2092566
chr11 71936440 rs549960240 G T 2092567
chr11 71936515 rs141770958 G A 2092568
chr11 71936576 rs77987571 G T 2092569
chr11 71936933 rs191772662 A C 2092570
chr11 71937141 rs144307763 T C 2092571
chr11 71937373 rs139549052 C T 2092572
chr11 71937416 rs187883049 G A 2092573
chr11 71937422 rs551749586 A C 2092574
chr11 71937600 rs73545661 A G 2092575
chr11 71937701 rs145063480 C T 2092576
chr11 71937883 rs79304956 G A 2092577
chr11 71937937 rs192618018 G A 2092578

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results