Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 72003135 72003262 vista10837

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 72003186 rs185465762 G A 2092977
chr11 72003296 rs190522332 G A 2092978
chr11 72003644 rs182746071 C T 2092979
chr11 72003767 rs526344 C A 2092980
chr11 72003919 rs146071204 C A 2092981
chr11 72003955 rs565094402 G GTGGAGCCATTCTGGGGACTGAGT 2092982
chr11 72003994 rs75201671 A C 2092983

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results