Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 78106545 78119815 enh14139
chr11 78113040 78113383 vista11031

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 78112352 rs73502963 C T 2128391
chr11 78112457 rs559417744 C T 2128392
chr11 78112552 rs11237483 G C 2128393
chr11 78112632 rs115126374 T C 2128394
chr11 78112635 rs140115721 C T 2128395
chr11 78112893 rs116637428 G T 2128396
chr11 78112935 rs565786683 C T 2128397
chr11 78113121 rs112000094 A C 2128398
chr11 78113134 rs111592114 TTC T 2128399
chr11 78113134 rs372069334 TTC T 2128400
chr11 78113332 rs549725979 AAGGAAGCCTTTGCTTTTTCTTCTCT A 2128401

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results