Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 118775785 118794195 enh2039
chr11 118788249 118788453 vista11763

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 118788517 rs73575424 C A 2301329
chr11 118788562 rs549072283 G A 2301330
chr11 118788760 rs189315712 C G 2301331
chr11 118788769 rs186418307 G T 2301332
chr11 118788950 rs112121289 G A,C 2301333
chr11 118788971 rs530661802 G GCTGTGTGTGTGTGTGTGTGTGTGT 2301334
chr11 118788980 rs115717851 G A 2301335
chr11 118789025 rs77825533 C A,T 2301336
chr11 118789026 rs11607239 G T 2301337
chr11 118789041 rs80166369 G A 2301338

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results