EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr11:118788629-118790822]
Chromosome characteristics of ZNF274[chr11:118788629-118790822]
Back to top
Enhancers possibly regulated by ZNF274[chr11:118788629-118790822]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr11 118775785 118794195 enh2039
Liver (HepG2) Cervix (HeLa-S3) Brain (SK-N-SH) Large Intestine Blood (OCI-LY7) Blood (GM12878) Muscle (A673) Blood (Karpas-422) Embryonic Stem Cell Line (H1-hESC) Thymus Heart
chr11 118790377 118790895 vista11764
VISTA
SNP sites on ZNF274[chr11:118788629-118790822]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr11 118788760 rs189315712 C G 2301331
chr11 118788769 rs186418307 G T 2301332
chr11 118788950 rs112121289 G A,C 2301333
chr11 118788971 rs530661802 G GCTGTGTGTGTGTGTGTGTGTGTGT 2301334
chr11 118788980 rs115717851 G A 2301335
chr11 118789025 rs77825533 C A,T 2301336
chr11 118789026 rs11607239 G T 2301337
chr11 118789041 rs80166369 G A 2301338
chr11 118789221 rs7934204 G C,T 2301339
chr11 118789226 rs550569933 G T 2301340
chr11 118789251 rs181499351 G C 2301341
chr11 118789297 rs577757242 C A 2301342
chr11 118789442 rs577341620 G A 2301343
chr11 118789500 rs150993239 TGA T 2301344
chr11 118789657 rs12294466 C T 2301345
chr11 118789662 rs77986361 C T 2301346
chr11 118789878 rs11217089 G A,C 2301347
chr11 118789930 rs140867922 G A 2301348
chr11 118789952 rs11217090 C T 2301349
chr11 118789980 rs532158097 G A 2301350
chr11 118790190 rs149749292 G A 2301351
chr11 118790355 rs577378869 G A,C 2301352
chr11 118790358 rs149211119 GGGTGT G 2301353
chr11 118790609 rs543376148 C G 2301354
chr11 118790625 rs114675076 G A 2301355
chr11 118790737 rs74889667 G A 2301356
chr11 118790758 rs147663091 C T 2301357
Genes possibly regulated by ZNF274[chr11:118788629-118790822]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr11:118788629-118790822]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results