Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 53726510 53726905 vista13521
chr12 53727672 53728041 vista13522

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 53726866 rs112410724 C G 2645635
chr12 53726899 rs182781432 C A 2645636
chr12 53727492 rs112007530 C A 2645637
chr12 53727511 rs138648748 G GCTTCCCTCTCTGAACCCCACGTT 2645638
chr12 53727511 rs6144721 G GCTTCCCTCTCTGAACCCCACGTT 2645639
chr12 53727545 rs930900 T C 2645640
chr12 53727580 rs187785688 G A 2645641
chr12 53727628 rs564426243 GACTGGTGTGCCTTCGTGTTGCAGGCATCTCCAGCTC G 2645642
chr12 53727631 rs551549166 T A 2645643
chr12 53727782 rs146735498 G A,T 2645644
chr12 53727842 rs375860385 G T 2645645
chr12 53727848 rs73311334 G T 2645646
chr12 53727955 rs2016266 G A,C 2645647
chr12 53728157 rs561994766 C T 2645648
chr12 53728161 rs529178340 C G 2645649
chr12 53728369 rs10783573 G A 2645650

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results