Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 53727672 53728041 vista13522

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 53727511 rs138648748 G GCTTCCCTCTCTGAACCCCACGTT 2645638
chr12 53727511 rs6144721 G GCTTCCCTCTCTGAACCCCACGTT 2645639
chr12 53727545 rs930900 T C 2645640
chr12 53727580 rs187785688 G A 2645641
chr12 53727628 rs564426243 GACTGGTGTGCCTTCGTGTTGCAGGCATCTCCAGCTC G 2645642
chr12 53727631 rs551549166 T A 2645643

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results