Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 53727672 53728041 vista13522

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 53727580 rs187785688 G A 2645641
chr12 53727628 rs564426243 GACTGGTGTGCCTTCGTGTTGCAGGCATCTCCAGCTC G 2645642
chr12 53727631 rs551549166 T A 2645643
chr12 53727782 rs146735498 G A,T 2645644
chr12 53727842 rs375860385 G T 2645645
chr12 53727848 rs73311334 G T 2645646

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results