Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 62639225 62644875 enh14766
chr12 62644447 62644716 vista13733

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 62644635 rs555378007 C T 2678993
chr12 62644731 rs181045787 C T 2678994
chr12 62644732 rs187128330 G A 2678995
chr12 62644738 rs537727126 A ACCAGCCAATCTCCAGCTAACCCAAAAATGCAT 2678996
chr12 62644933 rs574760571 C A 2678997

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results