Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 71770650 71771010 vista14006

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 71770915 rs146487543 AGACCAATCGGCTCTCTGTAAAATG A 2726352
chr12 71770933 rs540282644 T C 2726353
chr12 71771016 rs9971727 G C,T 2726354
chr12 71771032 rs184454233 A G 2726355
chr12 71771196 rs189596873 G C 2726356
chr12 71771199 rs181893921 G A 2726357
chr12 71771260 rs114754305 G A 2726358
chr12 71771267 rs145171652 C G 2726359
chr12 71771325 rs142361265 C T 2726360
chr12 71771372 rs185496175 C T 2726361
chr12 71771599 rs73152352 T G 2726362
chr12 71771605 rs74102196 A G 2726363
chr12 71771679 rs146476167 A G 2726364
chr12 71771821 rs148044575 C T 2726365

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results