Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 94696122 94696451 vista14502

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 94696099 rs17022386 T A,G 2819235
chr12 94696147 rs60624932 CATTTTATTCATTCGACAAATAT C 2819236
chr12 94696160 rs189295092 C T 2819237

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results