EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr12:107377556-107378016]
Chromosome characteristics of ZNF274[chr12:107377556-107378016]
Back to top
Enhancers possibly regulated by ZNF274[chr12:107377556-107378016]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 107377522 107377900 vista14776
VISTA
SNP sites on ZNF274[chr12:107377556-107378016]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 107377648 rs554765952 C G 2880085
chr12 107377726 rs78216161 A C 2880086
chr12 107377787 rs114508224 G A 2880087
chr12 107377855 rs576024681 TTCACAGCTTTCATTATCCAG T 2880088
chr12 107377905 rs181163419 T G 2880089
chr12 107377981 rs570793392 A G 2880090
Genes possibly regulated by ZNF274[chr12:107377556-107378016]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr12 107371069 107380944 - MTERFD3 ENSG00000120832.5 107380944 0.69 0.97 2928 12489
Expression level of Genes
Back to top
miRNAs possibly regulated by ZNF274[chr12:107377556-107378016]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results