EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr12:120103386-120103826]
Chromosome characteristics of ZNF274[chr12:120103386-120103826]
Back to top
Enhancers possibly regulated by ZNF274[chr12:120103386-120103826]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr12 120103394 120103720 vista15095
VISTA
SNP sites on ZNF274[chr12:120103386-120103826]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 120103488 rs139352433 A G 2942478
chr12 120103533 rs149510423 G A 2942479
chr12 120103548 rs78470993 C G 2942480
chr12 120103768 rs148641447 T C 2942481
chr12 120103815 rs563075744 G A 2942482
chr12 120103816 rs56215541 A G 2942483
chr12 120103822 rs529460350 CTCCTGGCTCCCATCCCTTT C 2942484
Genes possibly regulated by ZNF274[chr12:120103386-120103826]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr12 120105558 120119435 + PRKAB1 ENSG00000111725.6 120105558 0.83 0.99 1732 12593
Expression level of Genes
Back to top
miRNAs possibly regulated by ZNF274[chr12:120103386-120103826]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results