EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr13:113377311-113377651]
Chromosome characteristics of ZNF274[chr13:113377311-113377651]
Back to top
Enhancers possibly regulated by ZNF274[chr13:113377311-113377651]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr13 113356925 113401095 enh15512
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Colon (HCT116) Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Ovary Bone (Osteoblast) Thyroid Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Muscle (Myoblast) Spleen Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Heart
chr13 113377120 113377559 vista17116
VISTA
SNP sites on ZNF274[chr13:113377311-113377651]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr13 113377506 rs112282538 G A 3405769
chr13 113377507 rs77259078 A T 3405770
chr13 113377528 rs71446911 G T 3405771
chr13 113377599 rs146915840 T TCCCCACCTCCCCCCACCCC 3405772
chr13 113377633 rs558459279 T G 3405773
chr13 113377649 rs576671115 G C 3405774
Genes possibly regulated by ZNF274[chr13:113377311-113377651]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr13:113377311-113377651]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results