Chrom Start End Enhancer ID Tissues that enhancer appears More
chr13 114147699 114148153 vista17160

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr13 114147763 rs187753602 C A,G 3411046
chr13 114147809 rs76425685 C T 3411047
chr13 114147866 rs142087083 TGTGTACTTAAAGTTGTACAC T 3411048
chr13 114147877 rs551578931 A G 3411049
chr13 114147880 rs563516175 T G 3411050
chr13 114147997 rs2261163 T C 3411051
chr13 114148015 rs75451798 T G 3411052
chr13 114148101 rs547424112 T A 3411053
chr13 114148119 rs147400740 C CT 3411054

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results