Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 55585448 55585812 vista17863

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 55585796 rs72716677 G A 3559744
chr14 55585857 rs148436084 A ATATTTATCTTAGGAAGCTTCCACCCC 3559745
chr14 55585857 rs559553596 A ATATTTATCTTAGGAAGCTTCCACCCC 3559746
chr14 55585938 rs112151401 T C 3559747
chr14 55586286 rs2340930 C T 3559748
chr14 55586321 rs141550140 C T 3559749
chr14 55586384 rs116318183 G T 3559750

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr14 55590828 55612126 + LGALS3 ENSG00000131981.11 55590828 0.74 1.0 4408 13335


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results