EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr14:62035037-62035721]
Chromosome characteristics of ZZZ3[chr14:62035037-62035721]
Back to top
Enhancers possibly regulated by ZZZ3[chr14:62035037-62035721]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 62034641 62035051 vista18035
VISTA
SNP sites on ZZZ3[chr14:62035037-62035721]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 62035108 rs2251239 G T 3591949
chr14 62035176 rs554148172 G A 3591950
chr14 62035218 rs150760142 G A 3591951
chr14 62035219 rs536478381 G A 3591952
chr14 62035263 rs377760214 A G 3591953
chr14 62035400 rs75919543 G T 3591954
chr14 62035428 rs138069457 T TGACGCCGGGGTGCAGGTGGGAGC 3591955
chr14 62035474 rs201386257 GCGCTCGCC G 3591956
chr14 62035525 rs182615378 G C 3591957
chr14 62035549 rs115459793 C A 3591958
chr14 62035578 rs532690517 G C 3591959
chr14 62035588 rs148577525 C CT 3591960
chr14 62035688 rs143698643 G C 3591961
chr14 62035721 rs547394456 G A 3591962
Genes possibly regulated by ZZZ3[chr14:62035037-62035721]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr14 62037258 62125414 + RP11-47I22.3 ENSG00000232774.3 62037258 0.87 0.99 1537 13380
Expression level of Genes
Back to top
miRNAs possibly regulated by ZZZ3[chr14:62035037-62035721]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results