Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 95859673 95864057 enh44069
chr14 95861859 95861987 vista18957

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 95861914 rs550740998 G GTGCTCAAACTAATCTCGGCCCACGTGGGTGAGGGACTGA 3755794
chr14 95861937 rs17755312 C T 3755795
chr14 95861973 rs73336912 T C 3755796
chr14 95861988 rs11849043 C T 3755797

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results