| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr14 | 95859673 | 95864057 | enh44069 |
|
|
| chr14 | 95861859 | 95861987 | vista18957 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr14 | 95861914 | rs550740998 | G | GTGCTCAAACTAATCTCGGCCCACGTGGGTGAGGGACTGA | 3755794 | |
| chr14 | 95861937 | rs17755312 | C | T | 3755795 | |
| chr14 | 95861973 | rs73336912 | T | C | 3755796 | |
| chr14 | 95861988 | rs11849043 | C | T | 3755797 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|