EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr14:103731582-103732355]
Chromosome characteristics of ZNF274[chr14:103731582-103732355]
Back to top
Enhancers possibly regulated by ZNF274[chr14:103731582-103732355]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 103731470 103731636 vista19202
VISTA
SNP sites on ZNF274[chr14:103731582-103732355]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 103731722 rs149966698 C T 3812630
chr14 103731783 rs112348162 T C 3812631
chr14 103731797 rs10129761 T C 3812632
chr14 103731822 rs114376984 T C 3812633
chr14 103731876 rs112450696 G A 3812634
chr14 103731925 rs796977435 T TCTCTCTCTCTCTCTTTCTCTCA 3812635
chr14 103732115 rs79943784 T C 3812636
chr14 103732143 rs34113993 GCT G 3812637
chr14 103732143 rs868119256 GCT G 3812638
chr14 103732298 rs117225774 C A 3812639
chr14 103732340 rs144779578 T C 3812640
Genes possibly regulated by ZNF274[chr14:103731582-103732355]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr14:103731582-103732355]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results