Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 63894930 63894962 vista20290

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 63894203 rs576269624 C T 4021108
chr15 63894247 rs545768435 AGGCGAGGAGCACTGTGATG A 4021109
chr15 63894268 rs117524854 G A 4021110
chr15 63894319 rs186182706 A G 4021111
chr15 63894319 rs536990776 A AC 4021112
chr15 63894353 rs577695754 A G 4021113
chr15 63894400 rs3934552 T G 4021114
chr15 63894409 rs3934553 G A 4021115
chr15 63894557 rs547434041 G A 4021116
chr15 63894710 rs181811297 C T 4021117
chr15 63894723 rs569705354 T G 4021118
chr15 63894771 rs137961482 G A,C 4021119
chr15 63894786 rs555691384 A G 4021120
chr15 63894853 rs186795473 T C 4021121

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results