Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 612039 612238 vista21517

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 612268 rs547387518 G A 4247236
chr16 612403 rs149338211 C T 4247237
chr16 612413 rs201543475 CACACACGCAT C 4247238
chr16 612438 rs556339875 A G 4247239
chr16 612480 rs561213855 C A 4247240
chr16 612498 rs114218071 C G 4247241
chr16 612506 rs568339710 C CACA 4247242
chr16 612522 rs564795137 C G,T 4247243
chr16 612529 rs571696166 ACGTGTGCACACACACGCACATG A 4247244
chr16 612531 rs547205465 G A 4247245
chr16 612541 rs529685442 A G 4247246
chr16 612544 rs549265176 C T 4247247
chr16 612601 rs377469906 A G 4247248
chr16 612660 rs116259900 C T 4247249
chr16 612698 rs4984890 T C 4247250

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr16 616995 634136 + PIGQ ENSG00000007541.10 616995 0.81 0.99 4186 14350
chr16 616996 619495 + NHLRC4 ENSG00000257108.1 616996 0.87 0.89 4187 14351


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results