Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 3414643 3415237 vista21617

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 3415017 rs76690844 G A 4268982
chr16 3415026 rs115843726 C T 4268983
chr16 3415029 rs145210716 T G 4268984
chr16 3415036 rs140375448 A G 4268985
chr16 3415052 rs17136352 C G 4268986
chr16 3415054 rs118021056 T C 4268987
chr16 3415063 rs7404429 C T 4268988
chr16 3415085 rs115558355 C T 4268989
chr16 3415085 rs551396395 C CCCGCAACAGCTTCCGGCGTGCT,CCCGCAACAGCTTGCGGCGTGCT 4268990
chr16 3415098 rs78049588 C G 4268991
chr16 3415215 rs3859144 C G,T 4268992
chr16 3415227 rs3859145 A G 4268993

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr16 3415099 3536960 + NAA60 ENSG00000262621.2 3415099 0.93 1.0 110 14479


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results