Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 4818680 4818913 vista21661

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 4818904 rs115310258 C T 4278867
chr16 4818947 rs149308014 G A 4278868
chr16 4819081 rs77000082 C A,T 4278869
chr16 4819243 rs528214292 GCCATGAGAGGCATACAGTGGACAAAATTA G 4278870
chr16 4819265 rs79174078 C G 4278871
chr16 4819277 rs576261706 G A 4278872

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results