EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB33[chr16:12646659-12647159]
Chromosome characteristics of ZBTB33[chr16:12646659-12647159]
Back to top
Enhancers possibly regulated by ZBTB33[chr16:12646659-12647159]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 12630505 12654813 enh3901
Liver (HepG2) Esophagus Astrocyte Blood (OCI-LY7) Blood (GM12878) Blood (Karpas-422) Muscle (Myoblast) Muscle (Myotube) Thymus
chr16 12647143 12647394 vista21929
VISTA
SNP sites on ZBTB33[chr16:12646659-12647159]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 12646660 rs183749963 G A,C,T 4330368
chr16 12646662 rs2856785 G C,T 4330369
chr16 12646682 rs532163418 C T 4330370
chr16 12646687 rs189298993 G T 4330371
chr16 12646700 rs115056195 G A,C 4330372
chr16 12646759 rs538568459 G T 4330373
chr16 12646775 rs13332990 T C 4330374
chr16 12646835 rs543177499 G A,T 4330375
chr16 12646850 rs545801665 G A 4330376
chr16 12646893 rs117198849 G A 4330377
chr16 12646894 rs148700159 G A 4330378
chr16 12646903 rs142043696 T C 4330379
chr16 12646918 rs116551934 G A 4330380
chr16 12646933 rs112919998 C G 4330381
chr16 12646952 rs148976400 TGGCCTGGGGCTTTCAGGCTGGGAG T 4330382
chr16 12646952 rs372329360 TGGCCTGGGGCTTTCAGGCTGGGAG T 4330383
chr16 12647008 rs76005289 T C,G 4330384
chr16 12647010 rs75616669 C T 4330385
chr16 12647024 rs562036168 T G 4330386
chr16 12647052 rs139513244 G A,C 4330387
chr16 12647063 rs12933684 T G 4330388
chr16 12647064 rs76704088 A G 4330389
chr16 12647074 rs12928279 G A 4330390
chr16 12647086 rs368363078 T TA 4330391
chr16 12647096 rs77357675 A G 4330392
chr16 12647123 rs147600042 G A,T 4330393
Genes possibly regulated by ZBTB33[chr16:12646659-12647159]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB33[chr16:12646659-12647159]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results