Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 20913163 20913441 vista22101

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 20912932 rs117120550 G A 4367405
chr16 20912949 rs143395324 G A 4367406
chr16 20912959 rs528719812 A G,T 4367407
chr16 20912972 rs369247189 C T 4367408
chr16 20913105 rs371202589 CCTGTTAGGAGACTGTTGCA C 4367409
chr16 20913105 rs377043757 CCTGTTAGGAGACTGTTGCA C 4367410
chr16 20913167 rs569286835 G A 4367411
chr16 20913203 rs140306816 T C 4367412

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr16 20866247 20911706 - DCUN1D3 ENSG00000188215.5 20911706 0.67 1.0 981 14620


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results