Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 20913163 20913441 vista22101

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 20912972 rs369247189 C T 4367408
chr16 20913105 rs371202589 CCTGTTAGGAGACTGTTGCA C 4367409
chr16 20913105 rs377043757 CCTGTTAGGAGACTGTTGCA C 4367410
chr16 20913167 rs569286835 G A 4367411
chr16 20913203 rs140306816 T C 4367412
chr16 20913251 rs188992691 T C 4367413
chr16 20913316 rs534033260 C T 4367414
chr16 20913356 rs115643597 C A,G 4367415

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results