EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr16:20913103-20913221]
Chromosome characteristics of ZNF274[chr16:20913103-20913221]
Back to top
Enhancers possibly regulated by ZNF274[chr16:20913103-20913221]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 20913163 20913441 vista22101
VISTA
SNP sites on ZNF274[chr16:20913103-20913221]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 20913105 rs371202589 CCTGTTAGGAGACTGTTGCA C 4367409
chr16 20913105 rs377043757 CCTGTTAGGAGACTGTTGCA C 4367410
chr16 20913167 rs569286835 G A 4367411
chr16 20913203 rs140306816 T C 4367412
Genes possibly regulated by ZNF274[chr16:20913103-20913221]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr16:20913103-20913221]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results