Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 21295163 21295477 vista22106

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 21295034 rs140858237 C T 4368097
chr16 21295051 rs528890030 GCGTCCCCGGCTCCCCACACTC G 4368098
chr16 21295074 rs571492282 G C 4368099
chr16 21295306 rs370281985 C T 4368100
chr16 21295353 rs114375414 C T 4368101
chr16 21295383 rs2733913 C G 4368102
chr16 21295387 rs541265050 G C 4368103
chr16 21295415 rs574904375 C T 4368104
chr16 21295435 rs73541749 A G 4368105

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results