Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 29836245 29840795 enh16627
chr16 29836551 29836761 vista22340

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 29836558 rs112017496 C T 4406395
chr16 29836764 rs533903115 C T 4406396
chr16 29836797 rs146347803 A G 4406397
chr16 29836920 rs115273131 G A 4406398
chr16 29836921 rs540653992 TCCTGGTGCTGATGCAGGGGCAGTTG T 4406399
chr16 29836949 rs560548500 G A 4406400
chr16 29836952 rs138962212 G T 4406401
chr16 29836994 rs547989023 ACT A 4406402

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results