Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 70716686 70717066 vista22879

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 70716799 rs527260215 CACGGCCACAGGGTGGCGGGG C 4511489

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr16 70695107 70719969 - MTSS1L ENSG00000132613.10 70719969 0.69 0.99 3106 15030


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results