EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr16:86541399-86541709]
Chromosome characteristics of ZNF143[chr16:86541399-86541709]
Back to top
Enhancers possibly regulated by ZNF143[chr16:86541399-86541709]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 86541340 86541581 vista23395
VISTA
SNP sites on ZNF143[chr16:86541399-86541709]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 86541399 rs552200100 A G 4638258
chr16 86541405 rs139841545 G A 4638259
chr16 86541425 rs113919654 T G 4638260
chr16 86541444 rs150630839 G A 4638261
chr16 86541636 rs78396903 G A 4638262
chr16 86541649 rs550496036 C CGTGGGCGGTGCGGAGCGTGTCT 4638263
chr16 86541678 rs527496316 G A 4638264
Genes possibly regulated by ZNF143[chr16:86541399-86541709]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr16 86544133 86548076 + FOXF1 ENSG00000103241.5 86544133 0.89 1.0 2424 15137
Expression level of Genes
Back to top
miRNAs possibly regulated by ZNF143[chr16:86541399-86541709]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results