EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr16:86541566-86542457]
Chromosome characteristics of ZNF143[chr16:86541566-86542457]
Back to top
Enhancers possibly regulated by ZNF143[chr16:86541566-86542457]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 86541340 86541581 vista23395
VISTA
SNP sites on ZNF143[chr16:86541566-86542457]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 86541636 rs78396903 G A 4638262
chr16 86541649 rs550496036 C CGTGGGCGGTGCGGAGCGTGTCT 4638263
chr16 86541678 rs527496316 G A 4638264
chr16 86541788 rs76143066 T A,G 4638265
chr16 86541873 rs549544989 C G 4638266
chr16 86541934 rs146886904 C T 4638267
chr16 86541943 rs75079463 G T 4638268
chr16 86542078 rs371247085 C T 4638269
chr16 86542189 rs192545415 C A,G,T 4638270
chr16 86542241 rs76979688 G T 4638271
chr16 86542287 rs529719756 C T 4638272
chr16 86542324 rs75827089 C T 4638273
Genes possibly regulated by ZNF143[chr16:86541566-86542457]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr16 86544133 86548076 + FOXF1 ENSG00000103241.5 86544133 0.89 1.0 1676 15137
Expression level of Genes
Back to top
miRNAs possibly regulated by ZNF143[chr16:86541566-86542457]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results