Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 86587305 86587716 vista23396

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 86587620 rs373861750 CGGACCAATCGGCTCTCTGTAAAAT C 4638590
chr16 86587637 rs368004828 T C 4638591
chr16 86587718 rs181555310 C T 4638592
chr16 86587735 rs148876493 C A,T 4638593
chr16 86587737 rs186915557 C T 4638594

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr16 86563782 86588841 - MTHFSD ENSG00000103248.13 86588841 0.71 1.0 1084 15138


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results