Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 1386225 1394055 enh4197
chr17 1391218 1391783 vista23659

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 1391416 rs530618983 G C 4694166
chr17 1391419 rs181661578 C T 4694167
chr17 1391444 rs201698493 G GTCCGC 4694168
chr17 1391457 rs552925847 CT C 4694169
chr17 1391499 rs564828891 GGGGTCGGGCCCGCTTCTTCCAGTTCCC G 4694170
chr17 1391536 rs529323188 C T 4694171
chr17 1391552 rs549470252 T C 4694172
chr17 1391708 rs55640917 A G 4694173
chr17 1391709 rs551676467 C T 4694174
chr17 1391725 rs112594073 G A 4694175
chr17 1391764 rs150076236 C T 4694176
chr17 1391797 rs34582191 C T 4694177
chr17 1391814 rs190759411 G T 4694178

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr17 1367392 1396106 - MYO1C ENSG00000197879.10 1396106 0.7 1.0 4280 15217


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results