EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:1391462-1391682]
Chromosome characteristics of ZNF274[chr17:1391462-1391682]
Back to top
Enhancers possibly regulated by ZNF274[chr17:1391462-1391682]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 1386225 1394055 enh4197
Bone Marrow (K562) Blood (T-cell) Blood (Karpas-422)
chr17 1391218 1391783 vista23659
VISTA
SNP sites on ZNF274[chr17:1391462-1391682]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 1391499 rs564828891 GGGGTCGGGCCCGCTTCTTCCAGTTCCC G 4694170
chr17 1391536 rs529323188 C T 4694171
chr17 1391552 rs549470252 T C 4694172
Genes possibly regulated by ZNF274[chr17:1391462-1391682]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr17 1367392 1396106 - MYO1C ENSG00000197879.10 1396106 0.7 1.0 4424 15217
Expression level of Genes
Back to top
miRNAs possibly regulated by ZNF274[chr17:1391462-1391682]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results